A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Reverse(BVDV 57) primer
Oligo ID:pb00363
Oligo type: Denegeracy: 1
Target: 5231-5211 Tm: 76.4 C at salt 1000.0mMLength: 21
Sequence: CCTCTCGGCATGATCCCGAAA
(0 other experimental conditions)
Note: Specific to NS2-3 region.

Experimental condition used for the oligonucleotide

Common Data ID: BM0049 Publication date: 01/00
PMID: 10590128 GI: 2789676 Taxonomy ID:11099
Virus Name: pestivirus type 1, BVDV Product size (PCR):
bp
MgCl2: 2.8 mM dNTPs: 0.28 mM Type: RT-PCR
Temp (PCR cycle):(94C 30sec>54C 30sec>72C 30sec)*30
Buffer: 28mM Tris-HCl, pH 8.3, 84mM KCl
Polymerase: 0.06U/microL Taq poly (Appligene, Heidelberg, Germany)Cycler:
Note: Specific to NS2-3 region.

Total 1 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.