A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Forward(Ext F) primer
Oligo ID:pb00358
Oligo type: Denegeracy: 1
Target: 1007-1028 Tm: 78.5 C at salt 1000.0mMLength: 22
Sequence: CACGGACCTGGTGGACAAGAAG
(4 other experimental conditions)
Note: Specific to the gp I glycoprotein region.
Target given in article is 624-645.

Experimental condition used for the oligonucleotide

Common Data ID: BM0040 Publication date: 03/99
PMID: 10359157 GI: 330756 Taxonomy ID:10320
Virus Name: Bovine herpesvirus 1, BHV-1 Product size (PCR):
bp
MgCl2: 2.5 mM dNTPs: 200 mM Type: Nested PCR 1
Temp (PCR cycle):(95C 60sec>56C 60sec>72C 60sec)*35>72C 5min
Buffer: 10mM Tris-HCl (pH 8.3) 50mM KCl, 5% (w/v) glycerol
Polymerase: 0.05U/microL Taq DNA polyCycler:
Note: Specific to the gp I glycoprotein region.
Target given in article is 624-645.

Total 1 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.