A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Forward(PEST1) primer
Oligo ID:pb00354
Oligo type: Denegeracy: 1
Target: 324-343 Tm: 76.1 C at salt 1000.0mMLength: 20
Sequence: CCTGATAGGGTGCTGCAGAG
(1 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: BH0045 Publication date: 11/97
PMID: 9491443 GI: 9626649 Taxonomy ID:11099
Virus Name: Pestivirus type 1 Product size (PCR):
bp
MgCl2: 2.5 mM dNTPs: 0.4 mM Type: RT-PCR
Temp (PCR cycle):94C 5min>(94C 1min>56C 1min>72C 1min)*35>72C 10min
Buffer: 10mM Tris-HCl (pH 8.3), 50mM KCl
Polymerase: 0.025U/microL AmpliTaq DNA poly (Perkin-Elmer Cetus)Cycler: Programmable Thermal Controller (MJ Research Inc)
Note:

Total 1 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.