A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Reverse(OIBR22) primer
Oligo ID:pb00343
Oligo type: Denegeracy: 1
Target: 1554-1533 Tm: 76.6 C at salt 1000.0mMLength: 22
Sequence: TCTCGTCTCGCAGCATTTCGTC
(0 other experimental conditions)
Note: Used with OlBR21A in primary PCR.

Experimental condition used for the oligonucleotide

Common Data ID: BH0044 Publication date: 07/99
PMID: 10391508 GI: 330756 Taxonomy ID:35244
Virus Name: Bovine herpesvirus 5 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.1 mM Type: Nested PCR
Temp (PCR cycle):(94C 45sec>57C 60sec>72C 60sec)*5>(94C 45sec>53C 60sec>72C 60sec)*30
Buffer: 10mM Tris-HCl (pH 9.0), 50mM KCl, 0.1% BSA
Polymerase: 0.02U/microL Taq DNA poly (Perkin Elmer Cetus)Cycler: DNA Thermal Cycler (Perkin Elmer)
Note: Used with OlBR21A in primary PCR.

Total 1 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.