A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Reverse(P3) primer
Oligo ID:pb00314
Oligo type: Denegeracy: 1
Target: 395-371 Tm: 77.2 C at salt 1000.0mMLength: 25
Sequence: TCAACTCCATGTGCCATGTACAGCA
(1 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: BH0049 Publication date: 09/95
PMID: 8593411 GI: 7960753 Taxonomy ID:11100
Virus Name: Bovine viral diarrhea virus (isolate NADL), BVDV; Hog cholera virus (strain Brescia), HCV Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.05 mM Type: RT-PCR
Temp (PCR cycle):94C 75sec>(94C 45sec>60C 60sec>72C 60sec)*35>72C 6min
Buffer: 2mM Tris-HCl (pH 8.3), 26mM KCl, 0.6mM ethyleneglycoltetraacetic acid, 4% glycerol, 0.04% Tween 20
Polymerase: 0.025U/microL recombinant Tth DNA polyCycler:
Note:

Total 1 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.