A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Forward(E2inf) primer
Oligo ID:PB00159
Oligo type: Denegeracy: 1
Target: 2825-2846 Tm: 80.3 C at salt 1000.0mMLength: 22
Sequence: AACGGACCGGCCTTCCAGATGG
(0 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: BH0010 Publication date: 07/01
PMID: 11376844 GI: 9626649 Taxonomy ID:11099
Virus Name: pestivirus type 1 Product size (PCR):
bp
MgCl2: 1.25 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):(95C 45sec>50C 60sec>72C 60sec)*35
Buffer: reaction buffer (Biozym, Hess, Germany)
Polymerase: 0.025U/microL Tth poly (Biozym)Cycler:
Note:

Total 1 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.