A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Reverse(5gC-) primer
Oligo ID:MT00031
Oligo type: PCR Denegeracy: 1
Target: 345-324 Tm: 84 C at salt 1000.0mMLength: 22
Sequence: GCGTCCCCAAGGGCGTCTCGTC
(0 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: MT0003 Publication date: 03/97
PMID: 9376428 GI: 1173639 Taxonomy ID:35244
Virus Name: Bovine herpesvirus 5, BHV-5 Product size (PCR): 166 bp
MgCl2: 1.25 mM dNTPs: 0.2 mM Type: Nested PCR 2 (2)
Temp (PCR cycle):99C 8min>(97C 60sec>75C 45sec)*4>(97C 60sec>73C 45sec)*36>72C 5min
Buffer: 1x PCR Buffer II (Perkin-Elmer), 6% glycerol
Polymerase: 0.03U/microL Taq poly (Perkin-Elmer)Cycler:
Note:

Total 1 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.