A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Reverse(SP-FOR) primer
Oligo ID:MP08430
Oligo type: PCR Denegeracy: 1
Target: 551-570 Tm: 74.1 C at salt 1000.0mMLength: 20
Sequence: CTTCTCAGATCCCGAGTGTC
(0 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: MP0843 Publication date: 09/02
PMID: 12237113 GI: 5921457 Taxonomy ID:12110
Virus Name: Foot-and-mouth disease virus, FMDV Product size (PCR): N/A bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):94C 2min>(94C 60sec>55C 40sec>72C 60sec)*40>72C 10min
Buffer: 1x PCR buffer (Gibco-BRL)
Polymerase: 0.04U/microL Taq DNA poly (Gibco-BRL)Cycler: Robocycler (Stratagene)
Note:

Total 1 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.