A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Reverse(VAR2) primer
Oligo ID:MP04411
Oligo type: PCR Denegeracy: 1
Target: 761-739 Tm: 69.7 C at salt 1000.0mMLength: 23
Sequence: GTAGATGGTTCATTATCATTGTG
(0 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: MP0441 Publication date: 08/95
PMID: 7559950 GI: 510229 Taxonomy ID:10255
Virus Name: Variola virus, VAR Product size (PCR): N/A bp
MgCl2: 1.5 mM dNTPs: 0.025 mM Type: PCR
Temp (PCR cycle):(94C 1min>55C 2min>72C 3min)*25
Buffer: 50mM KCl, 10mM Tris-HCl (pH 8.3)
Polymerase: 0.025U/microL DNA poly (Perkin-Elmer Cetus Corp., Norwalk, Conn.)Cycler: Model 9600 thermal cycler (Perkin-Elmer Cetus)
Note:

Total 1 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.