A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Reverse(P33) primer
Oligo ID:MP0392
Oligo type: PCR Denegeracy: 1
Target: 3760-3741 Tm: 74.1 C at salt 1000.0mMLength: 20
Sequence: AGCTTGTACCAGGGTTTGGC
(11 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: MP0392 Publication date: 08/97
PMID: 9274816 GI: 3367676 Taxonomy ID:12122
Virus Name: Foot-and-mouth disease virus SAT 1 Product size (PCR): 246 bp
MgCl2: 1.5 mM dNTPs: 0.5 mM Type: RT-Multiplex PCR
Temp (PCR cycle):95C 1min>(95C 15sec>60C 60sec)*35>60C 6min
Buffer: 10mM Tris-HCl (pH 8.8), 50mM KCl, 0.1% Triton X-100
Polymerase: 0.025U/microL Golstar DNA poly (Eurogentec)Cycler: Gene Amp PCR System 9600 (Perkin-Elmer)
Note:

Total 1 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.