A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Reverse(B22) primer
Oligo ID:MP01431
Oligo type: PCR Denegeracy: 1
Target: 12483-12462 Tm: 74.7 C at salt 1000.0mMLength: 22
Sequence: ACCATGGACGTCGAGTTAACCT
(0 other experimental conditions)
Note: Target area found in article

Experimental condition used for the oligonucleotide

Common Data ID: MP0143 Publication date: 1999
PMID: 10403696 GI: 902376 Taxonomy ID:144353
Virus Name: bovine viral diarrhea virus, BVDV Product size (PCR): 347 bp
MgCl2: N/A mM dNTPs: N/A mM Type: RT-PCR
Temp (PCR cycle):(94C 1min>56C 1min>72C 1min)*35
Buffer: N/A
Polymerase: N/ACycler: N/A
Note: Target area found in article

Total 1 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.