A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Forward(MP01101) primer
Oligo ID:MP01100
Oligo type: PCR Denegeracy: 1
Target: 4934-4956 Tm: 69.7 C at salt 1000.0mMLength: 23
Sequence: GCAGATTTTGAAGAAAGACACTA
(2 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: MP0110 Publication date: 10/94
PMID: 7597858 GI: 9626649 Taxonomy ID:11100
Virus Name: bovine viral diarrhea virus (isolate NADL), BVDV Product size (PCR): 672 bp
MgCl2: 1.5 mM dNTPs: N/A mM Type: RT-PCR
Temp (PCR cycle):94C 45sec>(94C 45sec>55C 45sec[+2sec/cyc]>72C 30sec[+5sec/cyc])*35>72C 10min
Buffer: 50mM KCl, 10mM Tris-HCl (pH 9.0), 0.01% gelatin, 0.1% Triton X-100
Polymerase: 0.01U/microL Tth polyCycler:
Note:



Oligonucleotide information
Forward(MP01101) primer
Oligo ID:MP01100
Oligo type: PCR Denegeracy: 1
Target: 4934-4956 Tm: 69.7 C at salt 1000.0mMLength: 23
Sequence: GCAGATTTTGAAGAAAGACACTA
(2 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: MP0112 Publication date: 10/94
PMID: 7597858 GI: 9626649 Taxonomy ID:11100
Virus Name: bovine viral diarrhea virus (isolate NADL), BVDV Product size (PCR): 672 bp
MgCl2: 1.5 mM dNTPs: N/A mM Type: RT-Nested PCR 2
Temp (PCR cycle):94C 45sec>(94C 45sec>55C 45sec[+2sec/cyc]>72C 30sec[+5sec/cyc])*30>72C 10min
Buffer: 50mM KCl, 10mM Tris-HCl (pH 9.0), 0.01% gelatin, 0.1% Triton X-100
Polymerase: 0.01U/microL Tth polyCycler:
Note:



Oligonucleotide information
Forward(MP01101) primer
Oligo ID:MP01100
Oligo type: Denegeracy: 1
Target: 4934-4956 Tm: 69.7 C at salt 1000.0mMLength: 23
Sequence: GCAGATTTTGAAGAAAGACACTA
(2 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: MP0110 Publication date: 10/94
PMID: 7597858 GI: 9626649 Taxonomy ID:11100
Virus Name: bovine viral diarrhea virus (isolate NADL), BVDV Product size (PCR): 672 bp
MgCl2: 1.5 mM dNTPs: N/A mM Type: RT-PCR
Temp (PCR cycle):94C 45sec>(94C 45sec>55C 45sec[+2sec/cyc]>72C 30sec[+5sec/cyc])*35>72C 10min
Buffer: 50mM KCl, 10mM Tris-HCl (pH 9.0), 0.01% gelatin, 0.1% Triton X-100
Polymerase: 0.01U/microL Tth polyCycler:
Note:



Oligonucleotide information
Forward(MP01101) primer
Oligo ID:MP01100
Oligo type: Denegeracy: 1
Target: 4934-4956 Tm: 69.7 C at salt 1000.0mMLength: 23
Sequence: GCAGATTTTGAAGAAAGACACTA
(2 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: MP0112 Publication date: 10/94
PMID: 7597858 GI: 9626649 Taxonomy ID:11100
Virus Name: bovine viral diarrhea virus (isolate NADL), BVDV Product size (PCR): 672 bp
MgCl2: 1.5 mM dNTPs: N/A mM Type: RT-Nested PCR 2
Temp (PCR cycle):94C 45sec>(94C 45sec>55C 45sec[+2sec/cyc]>72C 30sec[+5sec/cyc])*30>72C 10min
Buffer: 50mM KCl, 10mM Tris-HCl (pH 9.0), 0.01% gelatin, 0.1% Triton X-100
Polymerase: 0.01U/microL Tth polyCycler:
Note:

Total 4 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.