A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Reverse(ND001) primer
Oligo ID:MP00830
Oligo type: Hybridization Denegeracy: 1
Target: 386-367 Tm: 72 C at salt 1000.0mMLength: 20
Sequence: TGTGCCATGTACAGCAGAGA
(0 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: MP0083 Publication date: 1991
PMID: 1850232 GI: 9626649 Taxonomy ID:11100
Virus Name: bovine viral diarrhea virus (isolate NADL), BVDV Product size (PCR): N/A bp
MgCl2: N/A mM dNTPs: N/A mM Type: Hybridization
Temp (PCR cycle):50C 2hr
Buffer: 6x NET, 0.1% SDS, 5x Denhardt's, and 1.5-2.0x 10^7 cpm of end labelled oligonucleotide
Polymerase: N/ACycler: N/A
Note:

Total 1 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.