A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Reverse(MP00812) primer
Oligo ID:MP00811
Oligo type: PCR Denegeracy: 1
Target: 10098-10079 Tm: 65.8 C at salt 1000.0mMLength: 20
Sequence: ACATCTCCTACTAAGTAGTA
(2 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: MP0081 Publication date: 01/94
PMID: 8011781 GI: 7960753 Taxonomy ID:11100
Virus Name: bovine viral diarrhea virus (isolate NADL), BVDV Product size (PCR): 205 bp
MgCl2: 1.4 mM dNTPs: 1.18 mM Type: RT-PCR
Temp (PCR cycle):(95C 1min>55C 1min>72C 2min)*40
Buffer: 40mM Tris-HCl, 60mM KCl, 1% gelatin, 5microL RT reaction
Polymerase: 0.5U/microL Taq poly (Promega, Madison, WI.)Cycler: N/A
Note:

Total 1 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.