A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Forward(p1) primer
Oligo ID:MP00790
Oligo type: PCR Denegeracy: 1
Target: N/A-N/A Tm: 74.7 C at salt 1000.0mMLength: 28
Sequence: ACGAGAATTAGAAAAGACACTCGTATAC
(0 other experimental conditions)
Note: Used with p2

Experimental condition used for the oligonucleotide

Common Data ID: MP0079 Publication date: 04/94
PMID: 7985409 GI: N/A Taxonomy ID:11101
Virus Name: pestivirus type 3, BDV Product size (PCR): N/A bp
MgCl2: 1.5 mM dNTPs: 1 mM Type: RT-PCR
Temp (PCR cycle):94C 2min>(94C 1min>55C 1min>72C 3min)*30>72C 30min
Buffer: 1x PCR Buffer (100mM KCl, 10mM Tris-HCl pH 8.3), 0.25mM dithiothreitol
Polymerase: 2.5U/microL Amplitaq poly (Perkin-Elmer Cetus Corp., Norwalk, CT)Cycler: N/A
Note: Used with p2

Total 1 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.