A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Reverse(B) primer
Oligo ID:MP00771
Oligo type: PCR Denegeracy: 1
Target: 5584-5558 Tm: 82.1 C at salt 1000.0mMLength: 27
Sequence: GGGATCCAGTCCCCTCCTCACTTTTAG
(0 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: MP0077 Publication date: 04/90
PMID: 2164736 GI: 7960753 Taxonomy ID:11100
Virus Name: bovine viral diarrhea virus (isolate NADL), BVDV Product size (PCR): N/A bp
MgCl2: 6 mM dNTPs: 0.1 mM Type: RT-PCR
Temp (PCR cycle):see additional note
Buffer: N/A
Polymerase: 2U Taq DNA poly (Perkin-Elmer Cetus)Cycler: N/A
Note:

Total 1 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.