A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Forward(PBVD4) primer
Oligo ID:MP00750
Oligo type: PCR Denegeracy: 1
Target: 386-410 Tm: 73.2 C at salt 1000.0mMLength: 23
Sequence: GAATTCAGCCTATTATGGACCCA
(1 other experimental conditions)
Note: Used with PBVD3

Experimental condition used for the oligonucleotide

Common Data ID: MP0075 Publication date: 12/89
PMID: 2162162 GI: 323205 Taxonomy ID:11100
Virus Name: bovine viral diarrhea virus (isolate NADL), BVDV Product size (PCR):
bp
MgCl2: 10 mM dNTPs: 200 mM Type: RT-PCR
Temp (PCR cycle):95C 3min>62C 5min>(95C 30sec>62C 45sec)*34>62C 10min
Buffer: 50mM Tris-HCl (pH 8.3), 50mM KCl, 1mM dithiothreitol, 1mM EDTA
Polymerase: 0.08U/microL Taq poly (Amersham corp.)Cycler:
Note: Used with PBVD3

Total 1 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.