A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Forward(Primer 2.1) primer
Oligo ID:MP00740
Oligo type: PCR Denegeracy: 1
Target: 9893-9912 Tm: 65.8 C at salt 1000.0mMLength: 20
Sequence: GATTTCAAGGGGACTTTTTT
(3 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: MP0074 Publication date: 03/94
PMID: 8068309 GI: 7960753 Taxonomy ID:144353
Virus Name: bovine viral diarrhea virus, BVDV Product size (PCR): 205 bp
MgCl2: 1 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):(95C 1min>55C 1min> 75C 2min)*40
Buffer: PCR buffer (Promega)
Polymerase: 0.25U/microL Taq poly (Promega)Cycler: N/A
Note:

Total 1 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.