A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Reverse(MP00702) primer
Oligo ID:MP00701
Oligo type: PCR Denegeracy: 1
Target: 7367-7348 Tm: 70 C at salt 1000.0mMLength: 20
Sequence: CAGTAGCGTAGATATACACG
(0 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: MP0070 Publication date: 10/94
PMID: 7524039 GI: 323205 Taxonomy ID:11100
Virus Name: bovine viral diarrhea virus (isolate NADL), BVDV Product size (PCR):
bp
MgCl2: 1.7 mM dNTPs: 0.25 mM Type: RT-PCR
Temp (PCR cycle):(94C 30sec>56C 1min>74C 1min)*30
Buffer: 10mM Tris-HCl pH 9.0, 50mM KCl, 0.1% (w/v) gelatine, 1% (v/v) Triton X-100
Polymerase: 0.01U/microL Taq poly (Stehelin, Basel, CH)Cycler: N/A
Note:

Total 1 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.