A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Forward(BVD-99) primer
Oligo ID:MP00530
Oligo type: PCR Denegeracy: 1
Target: 99-118 Tm: 74.1 C at salt 1000.0mMLength: 20
Sequence: AGGCTAGCCATGCCCTTAGT
(0 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: MP0053 Publication date: 02/95
PMID: 7714180 GI: 323205 Taxonomy ID:11100
Virus Name: bovine viral diarrhea virus (isolate NADL), BVDV Product size (PCR): 244 bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):42C 30min>95C 3min>(95C 30sec>58C 15sec>72C 30sec)*35>72C 10min
Buffer: 50mM KCl, 10mM Tris pH 9.0, 0.1% Triton X-100, 0.04U/mivroL RNase inhibitor (Professional Diagnostics, Edmonton, Alberta, Canada)
Polymerase: 0.01U/microL Taq poly (Fisher Scientific)Cycler: MJR model PTC100-60 (Fisher Scientific)
Note:

Total 1 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.