A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Reverse(326) primer
Oligo ID:MP00443
Oligo type: PCR Denegeracy: 1
Target: 347-327 Tm: 72.5 C at salt 1000.0mMLength: 21
Sequence: TCAACTCCATGTGCCATGTAC
(20 other experimental conditions)
Note: Used with 324 in one PCR detected virus only 10.5%, in second PCR used with UTR1 detected virus only 37%

Experimental condition used for the oligonucleotide

Common Data ID: MP0044 Publication date: 03/00
PMID: 10730955 GI: 14113964 Taxonomy ID:144353
Virus Name: bovine viral diarrhea virus, BVDV Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.23 mM Type: RT-PCR
Temp (PCR cycle):95C 4min>(95C 1min>56C 1.5min>74C 1min)*40
Buffer: 1x PCR buffer (Promega), 0.03U/microL Taq Extender (Stratagene)
Polymerase: 0.03U/microL Taq poly (Promega)Cycler: N/A
Note: Used with 324 in one PCR detected virus only 10.5%, in second PCR used with UTR1 detected virus only 37%

Total 1 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.