A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Forward(IBR TK1) primer
Oligo ID:MP00420
Oligo type: PCR Denegeracy: 1
Target: 973-994 Tm: 74.7 C at salt 1000.0mMLength: 22
Sequence: AGACCCCAGTTGTGATGAATGC
(2 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: MP0042 Publication date: 09/94
PMID: 7802385 GI: 221806 Taxonomy ID:10320
Virus Name: Bovine herpesvirus 1, BHV 1 Product size (PCR): 183 bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: PCR
Temp (PCR cycle):95C 1min>(95C 1min>61C 1min>72C 1min)*34>95C 1min>61C 1min>72C 5min
Buffer: 1.25x Taq polymerase buffer (62.5 mM KCl, 12.5mM Tris-HCl pH 9.0, 1% Triton X-100), 10% glycerol
Polymerase: 0.042U/microL Taq polyCycler: DNA thermal cycler (Perkin-Elmer Canada Ltd, Dartmouth, Nova Scotia, Canada.)
Note:



Oligonucleotide information
Forward(IBR TK1) primer
Oligo ID:MP00420
Oligo type: PCR Denegeracy: 1
Target: 973-994 Tm: 74.7 C at salt 1000.0mMLength: 22
Sequence: AGACCCCAGTTGTGATGAATGC
(2 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: BM1303 Publication date: 09/94
PMID: 7802385 GI: 221806 Taxonomy ID:10320
Virus Name: Bovine herpesvirus 1 Product size (PCR):
bp
MgCl2: 0.3 mM dNTPs: 0.04 mM Type: PCR
Temp (PCR cycle):95C 1min>(95C 1min>61C 1min>72C 1min)*35>72C 4min
Buffer: 1x Taq poly buffer, 6% glycerol
Polymerase: 0.025U/microL Taq DNA polyCycler: DNA thermal cycler (Perkin-Elmer)
Note:



Oligonucleotide information
Forward(IBR TK1) primer
Oligo ID:mp00420
Oligo type: Denegeracy: 1
Target: 973-994 Tm: 74.7 C at salt 1000.0mMLength: 22
Sequence: AGACCCCAGTTGTGATGAATGC
(2 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: MP0042 Publication date: 09/94
PMID: 7802385 GI: 221806 Taxonomy ID:10320
Virus Name: Bovine herpesvirus 1, BHV 1 Product size (PCR): 183 bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: PCR
Temp (PCR cycle):95C 1min>(95C 1min>61C 1min>72C 1min)*34>95C 1min>61C 1min>72C 5min
Buffer: 1.25x Taq polymerase buffer (62.5 mM KCl, 12.5mM Tris-HCl pH 9.0, 1% Triton X-100), 10% glycerol
Polymerase: 0.042U/microL Taq polyCycler: DNA thermal cycler (Perkin-Elmer Canada Ltd, Dartmouth, Nova Scotia, Canada.)
Note:



Oligonucleotide information
Forward(IBR TK1) primer
Oligo ID:mp00420
Oligo type: Denegeracy: 1
Target: 973-994 Tm: 74.7 C at salt 1000.0mMLength: 22
Sequence: AGACCCCAGTTGTGATGAATGC
(2 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: BM1303 Publication date: 09/94
PMID: 7802385 GI: 221806 Taxonomy ID:10320
Virus Name: Bovine herpesvirus 1 Product size (PCR):
bp
MgCl2: 0.3 mM dNTPs: 0.04 mM Type: PCR
Temp (PCR cycle):95C 1min>(95C 1min>61C 1min>72C 1min)*35>72C 4min
Buffer: 1x Taq poly buffer, 6% glycerol
Polymerase: 0.025U/microL Taq DNA polyCycler: DNA thermal cycler (Perkin-Elmer)
Note:

Total 4 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.