A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Reverse(MP00323) primer
Oligo ID:MP00323
Oligo type: PCR Denegeracy: 1
Target: 1946-1924 Tm: 80.4 C at salt 1000.0mMLength: 23
Sequence: AGAGGTCGACAAACACCCGCGGT
(1 other experimental conditions)
Note: Used with MP00322.

Experimental condition used for the oligonucleotide

Common Data ID: MP0032 Publication date: 05/95
PMID: 7636978 GI: 330764 Taxonomy ID:10320
Virus Name: Bovine herpesvirus 1, BHV-1 Product size (PCR):
bp
MgCl2: N/A mM dNTPs: N/A mM Type: PCR
Temp (PCR cycle):95C 3min>(95C 1min>65C 1min>72C 3min[+2sec/cyc])*40>72C 7min
Buffer: 10% gycerol
Polymerase: 0.02U/microL Taq polyCycler:
Note: Used with MP00322.

Total 1 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.