A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Forward(IBR3) primer
Oligo ID:MP00272
Oligo type: PCR Denegeracy: 1
Target: 237-263 Tm: 76 C at salt 1000.0mMLength: 27
Sequence: ATTTAAGTGCACACCGTGTTATTTGCG
(0 other experimental conditions)
Note: Used with IBR2 to amplify BHV-1.2. Derived from [GI:537304].

Experimental condition used for the oligonucleotide

Common Data ID: MP0027 Publication date: 07/96
PMID: 9035371 GI: 537306 Taxonomy ID:10323
Virus Name: Bovine herpesvirus type 1.1 (strain Cooper), BHV-1.1, Bovine herpesvirus 1.2, BHV-1.2 Product size (PCR): 550 bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: PCR
Temp (PCR cycle):95C 2min>(95C 1min>60C 1min>72C 2min[+5sec/cyc])*35
Buffer: 10mM Tris-HCl (pH 8.8), 50mM KCl, 0.1% Triton X-100
Polymerase: 0.04U/microL Taq polyCycler: model 480 DNA thermalcycler (Perkin Elmer Cetus)
Note: Used with IBR2 to amplify BHV-1.2. Derived from [GI:537304].

Total 1 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.