A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Forward(P1) primer
Oligo ID:MP00260
Oligo type: PCR Denegeracy: 1
Target: 311-330 Tm: 76.1 C at salt 1000.0mMLength: 20
Sequence: ACATGCTGGCGCTGATCGCA
(0 other experimental conditions)
Note: The article listed the sequence at 227-246 but the nucleotide sequence database used had it at 311-330.

Experimental condition used for the oligonucleotide

Common Data ID: MP0026 Publication date: 11/96
PMID: 9055637 GI: 330745 Taxonomy ID:10320
Virus Name: Bovine herpesvirus 1, BHV-1 Product size (PCR): 381 bp
MgCl2: N/A mM dNTPs: 8 mM Type: PCR
Temp (PCR cycle):(95C 1min>57C 2min>72C 1min)*5>(95C 40sec>57C 40sec>72C 40sec)*30
Buffer: 1x reaction Buffer
Polymerase: 0.02U/microL Taq poly (Bangalore Genie)Cycler: Perkin-Elmer-Cetus DNA thermal cycler
Note: The article listed the sequence at 227-246 but the nucleotide sequence database used had it at 311-330.

Total 1 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.