A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Forward(TK1) primer
Oligo ID:MP00230
Oligo type: PCR Denegeracy: 1
Target: 975-995 Tm: 72.5 C at salt 1000.0mMLength: 21
Sequence: ACCCCAGTTGTGATGAATGCA
(0 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: MP0023 Publication date: 04/95
PMID: 7648521 GI: 221806 Taxonomy ID:10322
Virus Name: Bovine herpesvirus 1 (strain 6660), BHV-1 Product size (PCR):
bp
MgCl2: 1.0 mM dNTPs: 0.2 mM Type: PCR
Temp (PCR cycle):95C 1min>(95C 1min>61C 1min>72C 1min)*35>72C 4min
Buffer: 1x Taq polymerase buffer, 10% glycerol
Polymerase: 0.025U/microL Taq poly (Bio-Can Scientific, Mississauga, Ontario)Cycler: DNA Thermocycler 480 (Perkin-Elmer)
Note:

Total 1 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.