A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Reverse(MP00222) primer
Oligo ID:MP00221
Oligo type: PCR Denegeracy: 1
Target: 468-445 Tm: 77 C at salt 1000.0mMLength: 24
Sequence: GAATGGCTTTGAGGGGCTGTAGAT
(0 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: MP0022 Publication date: 07/91
PMID: 1911989 GI: 331084 Taxonomy ID:35252
Virus Name: Alcelaphine herpesvirus 1, AHV-1 Product size (PCR): 172 bp
MgCl2: N/A mM dNTPs: N/A mM Type: Nested PCR 2
Temp (PCR cycle):94C 7min>(94C 60sec>62C 30sec>72C 75sec)*35>72C 7min
Buffer: recomended concentration of comercial reagant (Perkin-Elmer Cetus, Emeryville, CA)
Polymerase:
Cycler:
Note:

Total 1 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.