A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Forward(BHV1-4bF-INT) primer
Oligo ID:MP00190
Oligo type: PCR Denegeracy: 1
Target: 394-421 Tm: 80.6 C at salt 1000.0mMLength: 28
Sequence: ACGGTCATATGGTACAAGATCGAGAGCG
(0 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: MP0019 Publication date: 04/93
PMID: 8227276 GI: 330745 Taxonomy ID:10320
Virus Name: Bovine herpesvirus 1, BHV-1 Product size (PCR): 325 bp
MgCl2: 1.5 mM dNTPs: 0.1 mM Type: Nested PCR 2
Temp (PCR cycle):92C 4min>(94C 1min>60C 1min>72C 1min)*10>(94C 1min>65C 1min>72C 1min)*30>72C 6min
Buffer: 20mM Tris-HCl (pH 8.4), 50mM KCl, 8% DMSO
Polymerase: 0.06U/microL Taq poly (Gibco BRL)Cycler: Hybaid thermal reactor (National Labnet Co.; Woodbridge, NJ)
Note:

Total 1 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.