A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Forward(P1) primer
Oligo ID:MP00090
Oligo type: PCR Denegeracy: 1
Target: 624-645 Tm: 82.1 C at salt 1000.0mMLength: 25
Sequence: CACGGACCTGGTGGTGGACAAGAAG
(0 other experimental conditions)
Note: The target start and end in the article was not found in the GI found but an identicle series was found at 25217-25241

Experimental condition used for the oligonucleotide

Common Data ID: MP0009 Publication date: 06/95
PMID: 8701569 GI: 1491620 Taxonomy ID:10320
Virus Name: Bovine herpesvirus 1, BHV-1 Product size (PCR): 468 bp
MgCl2: N/A mM dNTPs: 16 mM Type: PCR
Temp (PCR cycle):(95C 1min>56C 1min>72C 1min)*35
Buffer: 2.5 microL 10x reaction buffer (Boehringer-Mannheim)
Polymerase: 0.5U/microL Taq poly (Boehringer-Mannheim)Cycler: Perkin-Elmer-Cetus DNA thermal cycler
Note: The target start and end in the article was not found in the GI found but an identicle series was found at 25217-25241

Total 1 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.