A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Forward(IB0) primer
Oligo ID:MP00082
Oligo type: hybridization Denegeracy: 1
Target: 1611-1640 Tm: 86.1 C at salt 1000.0mMLength: 30
Sequence: AGCCACACCTTCGCGTTGCAGAATGTGCCG
(0 other experimental conditions)
Note: Designed for Southern blot hybridization, labled with digoxigenin (DIG) 3' end labelling kit, Hybridization carried out overnight at 68c in same buffer as experiment with 4pmol/ml of DIG-labelled probe

Experimental condition used for the oligonucleotide

Common Data ID: MP0008 Publication date: 08/95
PMID: 8861645 GI: 330756 Taxonomy ID:10323
Virus Name: Bovine herpesvirus 1.1 (strain Cooper), BHV-1.1 Product size (PCR): 323 bp
MgCl2: 1.5 mM dNTPs: 0.1 mM Type: PCR
Temp (PCR cycle):(94C 30sec>58C 1min>72C 1min)*45>72C 10min
Buffer: 10mM Tris-HCl pH 8.3, 50mM KCL, 0.01%gelatine
Polymerase: 0.03U/microL Taq poly (Cetus, PerkinElmer)Cycler:
Note: Designed for Southern blot hybridization, labled with digoxigenin (DIG) 3' end labelling kit, Hybridization carried out overnight at 68c in same buffer as experiment with 4pmol/ml of DIG-labelled probe

Total 1 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.