A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Reverse(MP00072) primer
Oligo ID:MP00071
Oligo type: PCR Denegeracy: 1
Target: N/A-N/A Tm: 74.2 C at salt 1000.0mMLength: 26
Sequence: TTGCATTACTTTTGGGGTCAAATGTG
(1 other experimental conditions)
Note: No sequence match

Experimental condition used for the oligonucleotide

Common Data ID: MP0007 Publication date: 12/96
PMID: 9233501 GI: 330756 Taxonomy ID:10320
Virus Name: Bovine herpesvirus 1, BHV-1 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: PCR
Temp (PCR cycle):(95C 1min>60C 1min>72C 2min)*35
Buffer: 10mM Tris-HCL pH 8.8, 50mM KCL, 0.1% Triton X-100
Polymerase: 0.02U/microL Taq DNA polyCycler:
Note: No sequence match

Total 1 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.