A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Reverse(MP000102) primer
Oligo ID:MP000101
Oligo type: PCR Denegeracy: 1
Target: 1335-1278 Tm: 98.3 C at salt 1000.0mMLength: 57
Sequence: CTCGAGTCAACCGAACTGCGGGTGACGCCAAGCGCTCCCGGGCAGCGCGCTGTAGTT
(0 other experimental conditions)
Note: This primer contains the Streptag seqence and Xho I restriction site.
Streptag sequence: Sun, G., Budde, R.J.A., 1995. A modified pGEX expression system that eliminates degradation products and thrombin from the recombinant protein. Anal. Biochem. 231, 458-460.

Experimental condition used for the oligonucleotide

Common Data ID: MP0001 Publication date: 03/00
PMID: 10733743 GI: 312185 Taxonomy ID:10320
Virus Name: Bovine herpesvirus 1, BHV-1 Product size (PCR):
bp
MgCl2: 2.5 mM dNTPs: 0.2 mM Type: PCR
Temp (PCR cycle):(94C 30sec>52C 60sec>72C 60sec)*35>72C 10min
Buffer: 50mM KCl, 10mM Tris-Cl (pH 8.3), 1% DMSO, 5% glycerol, 0.1% NP40
Polymerase: 0.025U/microL Taq polyCycler: MJ Research Minicycle
Note: This primer contains the Streptag seqence and Xho I restriction site.
Streptag sequence: Sun, G., Budde, R.J.A., 1995. A modified pGEX expression system that eliminates degradation products and thrombin from the recombinant protein. Anal. Biochem. 231, 458-460.

Total 1 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.