A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Forward(BE) primer
Oligo ID:MO00041
Oligo type: PCR Denegeracy: 1
Target: 108-127 Tm: 74.4 C at salt 1000.0mMLength: 21
Sequence: CATGCCCTTAGTAGGACTAGC
(1 other experimental conditions)
Note: This primer is specific for pestivirus. Target area specified in the article and is only for 19 base pairs

Experimental condition used for the oligonucleotide

Common Data ID: MO0004 Publication date: 01/99
PMID: 10028170 GI: 9626649 Taxonomy ID:11099
Virus Name: pestivirus type 1 BVDV Product size (PCR): 287 bp
MgCl2: 3 mM dNTPs: 0.5 mM Type: RT-PCR
Temp (PCR cycle):95C 5min>(94C 1min>57C 1min>72C 1min)*35
Buffer: 20mM tris-HCl (pH 8.4); 50mM KCl
Polymerase: 0.05 U/microL Taq poly (GIBCO BRL)Cycler:
Note: This primer is specific for pestivirus. Target area specified in the article and is only for 19 base pairs

Total 1 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.