A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Forward(E) primer
Oligo ID:KS00262
Oligo type: Hybridization Denegeracy: 1
Target: 5559-5580 Tm: 74.7 C at salt 1000.0mMLength: 22
Sequence: TAAAAGTGAGGAGGGGTCTGGA
(0 other experimental conditions)
Note: Used in Southern blot hybridization.

Experimental condition used for the oligonucleotide

Common Data ID: KS0026 Publication date: 08/93
PMID: 8408445 GI: 9626649 Taxonomy ID:11099
Virus Name: pestivirus type 1, BVDV Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-Nested PCR 2
Temp (PCR cycle):94C 30sec>(94C 30sec>55C 45sec[+2sec/cyc]>72C 30sec[+5sec/cyc])*30>72C 10min
Buffer: 10mM Tris-HCl (pH 9.0), 50mM KCl, 0.01% gelatin, 0.1% Triton X-100
Polymerase: 0.01U/microL Tth poly (ITC; Heidelberg)Cycler:
Note: Used in Southern blot hybridization.

Total 1 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.