A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Reverse(P6) primer
Oligo ID:KS00215
Oligo type: PCR Denegeracy: 1
Target: 17299-17280 Tm: 76.1 C at salt 1000.0mMLength: 20
Sequence: ACTGGTTCCGCAACGGCTAC
(0 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: KS0021 Publication date: 12/97
PMID: 9607088 GI: 9629818 Taxonomy ID:10320
Virus Name: Bovine herpesvirus 1 Product size (PCR):
bp
MgCl2: 1.0 mM dNTPs: 0.2 mM Type: PCR
Temp (PCR cycle):(95C 1min>56C 1min>72C 1min)*35>72C 5min
Buffer: 10% glycerol, Taq polymerase buffer
Polymerase: 0.06U/microL Taq DNA polyCycler:
Note:

Total 1 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.