A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Forward(
) primer
Oligo ID:KS00033
Oligo type:
Denegeracy: 1
Target: 60355-60335 Tm: 72.5 C at salt 1000.0mMLength: 21
Sequence: GATCAACATTGACCACGCAAG
(0 other experimental conditions)
Note:

Experimental condition used for the oligonucleotide

Common Data ID: KS0003 Publication date: 03/99
PMID: 10233945 GI: 9629818 Taxonomy ID:79889
Virus Name: Bovine herpesvirus type 1.1, BHV-1 Product size (PCR): 203 bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):(95C 1min>49C 1min>72C 1min)*35
Buffer: PCR buffer, Q solution (Qiagen)
Polymerase: 0.1U/microL Taq poly (Qiagen)Cycler:
Note:

Total 1 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.