A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Forward(TS1) primer
Oligo ID:HI00060
Oligo type: PCR Denegeracy: 1
Target: 1684-1715 Tm: 75.6 C at salt 1000.0mMLength: 32
Sequence: TATATTATTTGGAGACAGTGAATGTAGTAGCT
(0 other experimental conditions)
Note: Multiple mismatches.

Experimental condition used for the oligonucleotide

Common Data ID: HI0006 Publication date: 10/95
PMID: 8578861 GI: 323205 Taxonomy ID:11100
Virus Name: bovine viral diarrhea virus (isolate NADL); pestivirus type 2 strain BVDV890; Border disease virus strain BD31 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 1.0 mM Type: RT-Nested PCR 2
Temp (PCR cycle):(94C 60sec>50C 45sec>72C 45sec)*25
Buffer: 50mM KCl, 10mM Tris-HCl (pH 8.3)
Polymerase: 0.025U/microL Amplitaq (Perkin-Elmer Cetus)Cycler:
Note: Multiple mismatches.

Total 1 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.