A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Reverse(3'BHV4) primer
Oligo ID:HI00024
Oligo type: PCR Denegeracy: 1
Target: 468-446 Tm: 73.2 C at salt 1000.0mMLength: 23
Sequence: TACTCTAAATGAGGCATCTGGGT
(2 other experimental conditions)
Note: Specific to BHV4 [GI:2832252].

Experimental condition used for the oligonucleotide

Common Data ID: HI0002 Publication date: 05/98
PMID: 9557713 GI: 2832250 Taxonomy ID:69955
Virus Name: Bovine lymphotropic herpesvirus; BLHV Product size (PCR):
bp
MgCl2: 2 mM dNTPs: 0.2 mM Type: Multiplex PCR
Temp (PCR cycle):94C 3min>65C 2min>72C 1min>(94C 30sec>63C 30sec>72C 15sec)*35
Buffer: 20mM Tris-HCl, pH8.4, 50mM KCl, 5% dimethyl sulfoxide
Polymerase: 0.05U/microL Tag poly (Gibco)Cycler: Omnigene thermal cycler (Hybaid Limited, Middlesex, UK)
Note: Specific to BHV4 [GI:2832252].



Oligonucleotide information
Reverse(3'BHV4) primer
Oligo ID:HI00024
Oligo type: PCR Denegeracy: 1
Target: 468-446 Tm: 73.2 C at salt 1000.0mMLength: 23
Sequence: TACTCTAAATGAGGCATCTGGGT
(2 other experimental conditions)
Note: Specific to BHV4 [GI:2832252].

Experimental condition used for the oligonucleotide

Common Data ID: HI0003 Publication date: 05/98
PMID: 9557713 GI: 59839 Taxonomy ID:69955
Virus Name: bovine lymphotropic herpesvirus, BLHV; Ovine herpesvirus 2, OHV2; Bovine herpesvirus 4, BHV4 Product size (PCR):
bp
MgCl2: 2.0 mM dNTPs: 0.2 mM Type: Nested PCR
Temp (PCR cycle):94C 3min>60C 2min>72C 1min>(94C 30sec>60C 60sec>72C 60sec)*35
Buffer: 20mM Tris HCl (pH8.4), 50mM KCl, 2.5% dimethyl sulfoxide
Polymerase: 0.05U/microL Taq poly (Gibco)Cycler: Omnigene thermal cycler (Hybaid Limited, Middlesex, UK)
Note: Specific to BHV4 [GI:2832252].



Oligonucleotide information
Reverse(3'BHV4) primer
Oligo ID:hi00024
Oligo type: Denegeracy: 1
Target: 468-446 Tm: 73.2 C at salt 1000.0mMLength: 23
Sequence: TACTCTAAATGAGGCATCTGGGT
(2 other experimental conditions)
Note: Specific to BHV4 [GI:2832252].

Experimental condition used for the oligonucleotide

Common Data ID: HI0002 Publication date: 05/98
PMID: 9557713 GI: 2832250 Taxonomy ID:69955
Virus Name: Bovine lymphotropic herpesvirus; BLHV Product size (PCR):
bp
MgCl2: 2 mM dNTPs: 0.2 mM Type: Multiplex PCR
Temp (PCR cycle):94C 3min>65C 2min>72C 1min>(94C 30sec>63C 30sec>72C 15sec)*35
Buffer: 20mM Tris-HCl, pH8.4, 50mM KCl, 5% dimethyl sulfoxide
Polymerase: 0.05U/microL Tag poly (Gibco)Cycler: Omnigene thermal cycler (Hybaid Limited, Middlesex, UK)
Note: Specific to BHV4 [GI:2832252].



Oligonucleotide information
Reverse(3'BHV4) primer
Oligo ID:hi00024
Oligo type: Denegeracy: 1
Target: 468-446 Tm: 73.2 C at salt 1000.0mMLength: 23
Sequence: TACTCTAAATGAGGCATCTGGGT
(2 other experimental conditions)
Note: Specific to BHV4 [GI:2832252].

Experimental condition used for the oligonucleotide

Common Data ID: HI0003 Publication date: 05/98
PMID: 9557713 GI: 59839 Taxonomy ID:69955
Virus Name: bovine lymphotropic herpesvirus, BLHV; Ovine herpesvirus 2, OHV2; Bovine herpesvirus 4, BHV4 Product size (PCR):
bp
MgCl2: 2.0 mM dNTPs: 0.2 mM Type: Nested PCR
Temp (PCR cycle):94C 3min>60C 2min>72C 1min>(94C 30sec>60C 60sec>72C 60sec)*35
Buffer: 20mM Tris HCl (pH8.4), 50mM KCl, 2.5% dimethyl sulfoxide
Polymerase: 0.05U/microL Taq poly (Gibco)Cycler: Omnigene thermal cycler (Hybaid Limited, Middlesex, UK)
Note: Specific to BHV4 [GI:2832252].

Total 4 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.