A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Forward(145) primer
Oligo ID:CW00272
Oligo type: Hydridization Probe Denegeracy: 1
Target: 7190-7230 Tm: 88 C at salt 1000.0mMLength: 40
Sequence: ATGCAAGTTGGATTGGCTCTGGGTGATCAGTCCTGGCCAT
(0 other experimental conditions)
Note: Probe for the genomic region p80 of BVDV strain NADL. Probe for PCR products. It was labelled with 32P at 5' end.

Experimental condition used for the oligonucleotide

Common Data ID: CW0027 Publication date: 01/92
PMID: 1311133 GI: 7960753 Taxonomy ID:144353
Virus Name: bovine viral diarrhea virus, BVDV, Border Disease Virus, BDV Product size (PCR): 482 bp
MgCl2: 3 mM dNTPs: 0.22 mM Type: RT-PCR
Temp (PCR cycle):(94C 1min>60C 2min>72C 4min)*50
Buffer: 50mM KCl, 0.20mg/microL gelatine
Polymerase: 0.02 U/microL Taq Poly (Perkin Elmer Cetus Corp.)Cycler: Thermocycler (Perkin Elmer Cetus Corp.)
Note: Probe for the genomic region p80 of BVDV strain NADL. Probe for PCR products. It was labelled with 32P at 5' end.

Total 1 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.