A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Forward(180L) primer
Oligo ID:CW00271
Oligo type: PCR Denegeracy: 1
Target: 6976-7016 Tm: 87 C at salt 1000.0mMLength: 40
Sequence: CCAGGAAACAGCAACAGGGTCAAAGGACTACCACTATGAC
(0 other experimental conditions)
Note: Codes for the genomic region p80 of BVDV strain NADL. Primer used for PCR.

Experimental condition used for the oligonucleotide

Common Data ID: CW0027 Publication date: 01/92
PMID: 1311133 GI: 7960753 Taxonomy ID:144353
Virus Name: bovine viral diarrhea virus, BVDV, Border Disease Virus, BDV Product size (PCR): 482 bp
MgCl2: 3 mM dNTPs: 0.22 mM Type: RT-PCR
Temp (PCR cycle):(94C 1min>60C 2min>72C 4min)*50
Buffer: 50mM KCl, 0.20mg/microL gelatine
Polymerase: 0.02 U/microL Taq Poly (Perkin Elmer Cetus Corp.)Cycler: Thermocycler (Perkin Elmer Cetus Corp.)
Note: Codes for the genomic region p80 of BVDV strain NADL. Primer used for PCR.

Total 1 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.