A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Forward(CW00133) primer
Oligo ID:CW00133
Oligo type: PCR Denegeracy: 1
Target: 6153,6207-6173,6225 Tm: 88.6 C at salt 1000.0mMLength: 37
Sequence: TGAGACATCTGGGAGTGCTTCTGCCAGGGTCACTTGC
(0 other experimental conditions)
Note: These Primers were used as the coamplified internal control.
Paired with CW000134

Experimental condition used for the oligonucleotide

Common Data ID: CW0013 Publication date: 01/2000
PMID: 10652997 GI: 562277 Taxonomy ID:10385
Virus Name: Bovine herpesvirus 4, BHV4 Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: Multiplex PCR
Temp (PCR cycle):(94C 1min>55C 1.5min>72C 2min)*35
Buffer: 1x PCR Buffer, 5microL glycercol
Polymerase: 0.02U/microL Taq poly (Perkin Elmer)Cycler: DNA thermal cycler (Perkin-Elmer-Cetus)
Note: These Primers were used as the coamplified internal control.
Paired with CW000134

Total 1 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.