A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Reverse(CW00082) primer
Oligo ID:CW00082
Oligo type: Hybridization Denegeracy: 1
Target: 22655-22629 Tm: 82.1 C at salt 1000.0mMLength: 27
Sequence: TTTCCTTTGGCCCTGATGACTGCCGAG
(0 other experimental conditions)
Note: Hybridization Probe specific to RR transcript
Pre-hybridization 63C 60 min in 1x SSPE (150 mM NaCl,10 mM NaH2PO4, 1mM EDTA; PH7), 0.2xBP (1XBP is 2% bovine serum albumin, 2% polyvinylpyrolidone) plus 1%SDS.
Hybridization 62C 180 min in 1x SSPE-0.2XBP-1%SDS
Post-Hybridization: Wash at Room temperature for 5min in 0.005 SSPE-0.05%SDS three times.

Experimental condition used for the oligonucleotide

Common Data ID: CW0008 Publication date: 09/97
PMID: 9261403 GI: 9629818 Taxonomy ID:10320
Virus Name: Bovine herpesvirus 1, BHV 1 Product size (PCR): N/A bp
MgCl2: 1.5 mM dNTPs: 0.2 mM Type: PCR
Temp (PCR cycle):(95C 1min>65C 1min>72C 2min)*40
Buffer: 1x Commerical PCR buffer
Polymerase: 0.33 U/microL Taq polyCycler: N/A
Note: Hybridization Probe specific to RR transcript
Pre-hybridization 63C 60 min in 1x SSPE (150 mM NaCl,10 mM NaH2PO4, 1mM EDTA; PH7), 0.2xBP (1XBP is 2% bovine serum albumin, 2% polyvinylpyrolidone) plus 1%SDS.
Hybridization 62C 180 min in 1x SSPE-0.2XBP-1%SDS
Post-Hybridization: Wash at Room temperature for 5min in 0.005 SSPE-0.05%SDS three times.

Total 1 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.