A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Reverse(CW00061) primer
Oligo ID:CW00061
Oligo type: PCR Denegeracy: 1
Target: 129900-129879 Tm: 80.3 C at salt 1000.0mMLength: 22
Sequence: TTCTGCTCCTTCGTCCCCGCTG
(0 other experimental conditions)
Note: specific to IETU1/E1 transcript

Experimental condition used for the oligonucleotide

Common Data ID: CW0006 Publication date: 09/97
PMID: 9261403 GI: 9629818 Taxonomy ID:10320
Virus Name: Bovine herpesvirus 1, BHV 1 Product size (PCR): N/A bp
MgCl2: 1.0 mM dNTPs: 0.2 mM Type: PCR
Temp (PCR cycle):(95C 1min> 65C 1min> 72C 2min)*40
Buffer: 1x Commerical PCR buffer
Polymerase: 0.33 U/microL Taq polyCycler: N/A
Note: specific to IETU1/E1 transcript

Total 1 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.