A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Reverse(P1) primer
Oligo ID:BH00562
Oligo type: PCR Denegeracy: 1
Target: 3578-3558 Tm: 80.3 C at salt 1000.0mMLength: 21
Sequence: GAAGGGCCCAGGGTTGGACTC
(16 other experimental conditions)
Note: Target found in BLAST differs than that given in article (3592-3572).

Experimental condition used for the oligonucleotide

Common Data ID: BH0056 Publication date: 04/93
PMID: 8391540 GI: 61076 Taxonomy ID:12118
Virus Name: Foot-and-mouth disease virus O, FMDV Product size (PCR):
bp
MgCl2: 1.5 mM dNTPs: 0.04 mM Type: RT-PCR
Temp (PCR cycle):100C 2min>(94C 30sec>60C 30sec>72C 120sec)*30
Buffer: 66mM Tris-HCl (pH 8.8), 16.6mM (NH4)2SO4, 10mM beta-mercaptoethanol, 8.4ng/microL BSA
Polymerase: 0.04U/microL polyCycler: Intelligent Heating Block (Hybaid)
Note: Target found in BLAST differs than that given in article (3592-3572).

Total 1 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.