A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Forward(B7A) primer
Oligo ID:AM00190
Oligo type: PCR Denegeracy: 1
Target: 308-332 Tm: 77.2 C at salt 1000.0mMLength: 25
Sequence: CATCAATCCAAAGCACCACACTGTC
(3 other experimental conditions)
Note: Primer from the G gene.
GI # 2117036.

Experimental condition used for the oligonucleotide

Common Data ID: AM0019 Publication date: 08/98
PMID: 9880007 GI: 2117036 Taxonomy ID:11246
Virus Name: Bovine respiratory syncytial virus, BRSV Product size (PCR): 417 bp
MgCl2: 2.18 mM dNTPs: 0.2 mM Type: RT-PCR
Temp (PCR cycle):(94C 1min>60C 1min>72C 90sec)*35>72C 5min30sec
Buffer: 10mM Tris-HCl[pH 9.0], 50mM KCl
Polymerase: 0.02U/microL Taq poly(Perkin Elmer)Cycler: Perkin Elmer Thermocyclers
Note: Primer from the G gene.
GI # 2117036.

Total 1 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.