A Simple Solution for Oligonucleotide Design


Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:



Oligonucleotide information
Reverse(HexAA1913) primer
Oligo ID:AM00172
Oligo type:
Denegeracy: 1
Target: 19158-19136 Tm: 80.4 C at salt 1000.0mMLength: 23
Sequence: CAGCACGCCGCGGATGTCAAAGT
(18 other experimental conditions)
Note: This is the original primer.
GI: 9626158.

Experimental condition used for the oligonucleotide

Common Data ID: AM0017 Publication date: 04/96
PMID: 8908748 GI: 209938 Taxonomy ID:10546
Virus Name: Bovine adenovirus, BAV; Ovine adenovirus, OAV; Porcine adenovirus, PAV Product size (PCR): 301 bp
MgCl2: 1.5 mM dNTPs: 0.3 mM Type: PCR
Temp (PCR cycle):94C 9.5min>(94C 30sec>55C 30sec>72C 30sec)*35>72C 4.5min
Buffer: 50mM KCl, 10mM Tris-HCl [pH 9.0]
Polymerase: 0.02U/microL Taq polyCycler: DNA Thermal Cycler(Perkin Elmer Cetus) or PDR 91 DNA reproducer(BLS Ltd.)
Note: This is the original primer.
GI: 9626158.

Total 1 Oligos
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.