A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: ta0041Publication date: 12/02
PMID: 12435688GI: 9626649 Taxonomy ID: 144353
Virus Name: Bovine viral diarrhea virus, BVDVProduct size (PCR):
bp
MgCl2:
mM
dNTPs: mMType: Q-RT-PCR
Temp (PCR cycle):
Buffer:
Polymerase:
Cycler:
Note: Q-RT-PCR was performed by using QIAamp Viral RNAmini kit (Qiagen)
Forward(ta00411) primer
Oligo type: Hybridization ProbeDegeneracy: 1
Target: 11879-11853Tm: 80.5 C at salt 1000.0mMLength:
Sequence: AAATCCTCCTAACAAGCGGGTTCCAGG
(0 other experimental conditions)
Note:
Forward(ta00410) primer
Oligo type: Forward PrimerDegeneracy: 1
Target: 11827-11849Tm: 73.2 C at salt 1000.0mMLength:
Sequence: AGCCTTCAGTTTCTTGCTGATGT
(0 other experimental conditions)
Note:
Reverse(ta00412) primer
Oligo type: Reverse PrimerDegeneracy: 1
Target: 11901-11882Tm: 72 C at salt 1000.0mMLength:
Sequence: TGTTGCGAAAGGACCAACAG
(0 other experimental conditions)
Note:
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.