A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: YS0012Publication date: 11/17/2003
PMID: 14624234GI: 9629636 Taxonomy ID: 223358
Virus Name: Taino tomato mottle virusProduct size (PCR): bp
MgCl2: mMdNTPs: mMType: Hybridization
Temp (PCR cycle):
Buffer:
Polymerase: Cycler:
Note: Microarray hybridization conditions as described in David Wang et al., (2003) [pmid: 12429852]
(10005636) primer
Oligo type: Degeneracy: 1
Target: -Tm: 92.26C at salt 1000.0 mMLength:
Sequence: ACAACTGCACGAATAACAGATTCTTCGATGTGGTCTCCCCAACCAGGTCAGCACATTTCCATCCGAACAT
(0 other experimental conditions)
Note:
(10005635) primer
Oligo type: Degeneracy: 1
Target: -Tm: 92.26C at salt 1000.0 mMLength:
Sequence: ATGTTCGGATGGAAATGTGCTGACCTGGTTGGGGAGACCACATCGAAGAATCTGTTATTCGTGCAGTTGT
(0 other experimental conditions)
Note:
(10005634) primer
Oligo type: Degeneracy: 1
Target: -Tm: 91.09C at salt 1000.0 mMLength:
Sequence: CAATCAAACTGCAAGTACGGTAAGCCAGTTCAAATTAAAGGCGGAATCCCAGCAATCGTGCTTTGCAATC
(0 other experimental conditions)
Note:
(10005633) primer
Oligo type: Degeneracy: 1
Target: -Tm: 91.09C at salt 1000.0 mMLength:
Sequence: GATTGCAAAGCACGATTGCTGGGATTCCGCCTTTAATTTGAACTGGCTTACCGTACTTGCAGTTTGATTG
(0 other experimental conditions)
Note:
(10005632) primer
Oligo type: Degeneracy: 1
Target: -Tm: 95.77C at salt 1000.0 mMLength:
Sequence: CGGGACATGGATTCACGCACAGGGGAACTCATCACTGCACATCAGGCGGAGAATGGCGTGTATATCTGGG
(0 other experimental conditions)
Note:
(10005631) primer
Oligo type: Degeneracy: 1
Target: -Tm: 95.77C at salt 1000.0 mMLength:
Sequence: CCCAGATATACACGCCATTCTCCGCCTGATGTGCAGTGATGAGTTCCCCTGTGCGTGAATCCATGTCCCG
(0 other experimental conditions)
Note:
(10005630) primer
Oligo type: Degeneracy: 1
Target: -Tm: 92.26C at salt 1000.0 mMLength:
Sequence: GCACATTTCCATCCGAACATACAGGGAGCTAAATCCAGCTCCGACGTCAAAACATACATTACCAAGGACG
(0 other experimental conditions)
Note:
(10005629) primer
Oligo type: Degeneracy: 1
Target: -Tm: 92.26C at salt 1000.0 mMLength:
Sequence: CGTCCTTGGTAATGTATGTTTTGACGTCGGAGCTGGATTTAGCTCCCTGTATGTTCGGATGGAAATGTGC
(0 other experimental conditions)
Note:
(10005628) primer
Oligo type: Degeneracy: 1
Target: -Tm: 89.33C at salt 1000.0 mMLength:
Sequence: TATACAGGATTAGAGGCATGAGTACATGCCATATACAATAATAGGGCGTTCTCCGTATGATTCTCGTACT
(0 other experimental conditions)
Note:
(10005627) primer
Oligo type: Degeneracy: 1
Target: -Tm: 89.33C at salt 1000.0 mMLength:
Sequence: AGTACGAGAATCATACGGAGAACGCCCTATTATTGTATATGGCATGTACTCATGCCTCTAATCCTGTATA
(0 other experimental conditions)
Note:
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.