A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: VW0024Publication date: 07/93
PMID: 8373845GI: 210828 Taxonomy ID: 150548
Virus Name: Bovine respiratory syncytial virus A51908, BRSV, Human respiratory syncytial virus (subgroup A / strain Long), HRSVProduct size (PCR):
bp
MgCl2: N/A mMdNTPs: mMType: RT-PCR
Temp (PCR cycle):95C 30sec>(95C 15sec>60C 15sec)*35>60C 105sec
Buffer: N/A
Polymerase: N/ACycler: GeneAmp PCR System 9600 (Perkin Elmer)
Note: Each primer set is used in a separate PCR:
Primer set VW00241/VW242 [GI:210828] amplify BRSV [Taxonomy:150548].
Primer set VW00241/VW242 [GI:9629198] amplify HRSV [Taxonomy:11260].

RT-PCR is performed using a GeneAmp RNA PCR Kit (Perkin Elmer) according to manufacturer's instructions.
Total RT volume is 20microL containing 50-150ng/microL RNA and 1microM reverse primer.
RT temperature: 42C 225sec>99C 75sec>5C 75sec.
Total PCR volume is 100microL containing 1microM forward primer and all 20microL cDNA, as per kit instructions.
Forward(VW00241) primer
Oligo type: PCRDegeneracy: 1
Target: 741-760Tm: 72 C at salt 1000.0mMLength:
Sequence: TTACCACACCCCTCAGTACA
(1 other experimental conditions)
Note: BRSV specific primer. Derived from [GI:210828].
Reverse(VW00242) primer
Oligo type: PCRDegeneracy: 1
Target: 1123-1104Tm: 70 C at salt 1000.0mMLength:
Sequence: CATTGTGTCACAGAACACTC
(1 other experimental conditions)
Note: BRSV specific primer. Derived from [GI:210828].
Forward(VW00243) primer
Oligo type: PCRDegeneracy: 1
Target: 6227-6246Tm: 65.8 C at salt 1000.0mMLength:
Sequence: TTAACCAGCAAAGTGTTAGA
(6 other experimental conditions)
Note: HRSV specific primer. Derived from [GI:9629198].
Reverse(VW00244) primer
Oligo type: PCRDegeneracy: 1
Target: 6468-6448Tm: 64.6 C at salt 1000.0mMLength:
Sequence: TTTGTTATAGGCATATCATTG
(2 other experimental conditions)
Note: HRSV specific primer. Derived from [GI:9629198].
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.