A Simple Solution for Oligonucleotide Design

Click here for a list of viruses in the database


Two search options:
1. Search by virus name and/or primer data
2. Search by PMID, VirOligoID, or taxonomy ID;

Virus name:

Oligo Sequence:

Tm:
°C± °C
Oligo length:
bp± bp



PMID:

Common Data ID:

Taxonomy ID:

GI Number:

CommonData ID: VW0003Publication date: 12/99
PMID: 10598094GI: 58689 Taxonomy ID: 10385
Virus Name: Bovine herpesvirus 4, BHV4Product size (PCR): 179 bp
MgCl2: 2.5 mMdNTPs: mMType: PCR
Temp (PCR cycle):94C 15min>(94C 1min>58C 1min>70C 2min)*40>72C 10min
Buffer: 60mM Tris-HCl (pH 8.5), 15mM (NH4)2SO4, 0.2mM dUTP
Polymerase: 0.025U/microLTaq poly (Perkin Elmer/Applied Biosystems)Cycler: Thermocycler 60/2 (bio-med, Theres)
Note: Total PCR volume is 100microL containing DNA and 0.3microM each primer.
dNTPs used are dATP, dCTP, dGTP, and dUTP.
Forward(F1) primer
Oligo type: PCRDegeneracy: 1
Target: 1242-1266Tm: 77.2 C at salt 1000.0mMLength:
Sequence: CCATATCAGAGATGGGGAGGTAAAG
(0 other experimental conditions)
Note:
Forward(B1) primer
Oligo type: PCRDegeneracy: 1
Target: 1420-1396Tm: 77.2 C at salt 1000.0mMLength:
Sequence: CGCCTTGGAAGGTCTTTGTATCTAC
(1 other experimental conditions)
Note:
Forward(B1) primer
Oligo type:
Degeneracy: 1
Target: 1420-1496Tm: 77.2 C at salt 1000.0mMLength:
Sequence: CGCCTTGGAAGGTCTTTGTATCTAC
(1 other experimental conditions)
Note:
Copyright © 2001-2005 VirOligo Database Project. All rights reserved Feedback is welcome. Contact webmaster Ulrich Melcher at ulrich.melcher@okstate.edu.